Journal: The FASEB Journal

Article Title: The importance of the ZBED6‐IGF2 axis for metabolic regulation in mouse myoblast cells

doi: 10.1096/fj.201901321r

Figure Lengend Snippet: FIGURE 1 Knockout of Zbed6 or its binding site in Igf2 alter the growth of myoblasts. A, Schematic description of Zbed6 targeting using CRISPR/Cas9. Red scissors indicate the targeted sites of Zbed6 using two gRNAs. Blue arrows indicate the location of the PCR primers that were used for genotyping of the KO clones. B, Schematic description of the targeted ZBED6 binding sequences in Igf2 (bold). The scissor indicates the cleavage site using specific gRNA sequences (yellow) adjacent to the PAM sequences (blue). Black arrows indicate Igf2 promoters, red boxes are the coding sequences of Igf2. C, PCR screening of Zbed6 KO clones. D, Immunoblot validation of Zbed6−/− clones, the Igf2ΔGGCT clone and WT cells, NSB: non-specific band. E, Real-time measurements of cell growth (mean ± SEM) of WT C2C12 cells (black) and Zbed6−/− clones (red) (n = 3). F, Cell growth of two Igf2-mutant clones (red) and WT cells (black). G, Cell growth measurement of WT C2C12 cells at different passages (P5, P12, and P20) and WT cells transfected with Cas9 reagents without gRNA (WT Cas9). H, Quantitative PCR analysis of the Igf2 mRNA expression after transient expression of ZBED6-GFP in WT cells, Zbed6−/− and Igf2ΔGGCT cells. I, Quantitative PCR analysis of the Zbed6 mRNA expression and after transient expression of GFP (Control) or ZBED6-GFP (ZBED6-OE) constructs in myoblasts. J, Immunoblot validation of ZBED6-GFP overexpression in C2C12 cells. Graph shows the fold changes (mean ± SEM) compared to WT control cells. ns = non significant, **P < .01, ***P < .001, Student's t test

Article Snippet: Mouse myoblast C2C12 cells were obtained from ATCC (CRL-1772), and it is a subclone of the previously established mouse myoblast cell line.11 The cells were maintained in Dulbecco's Modified Eagle Medium (DMEM) with 2 mM lglutamine, 1 mM sodium pyruvate, and 4.5 g/L of glucose (ATCC 30-2001), supplemented with 10% (v/v) heat-inactivated fetal bovine serum (FBS) and penicillin (0.2 U/mL)/ streptomycin (0.2 μg/mL)/l-glutamine (0.2 μg/mL) (Gibco) at 37°C in a 5% CO2 humidified atmosphere.

Techniques: Knock-Out, Binding Assay, CRISPR, Clone Assay, Western Blot, Biomarker Discovery, Mutagenesis, Transfection, Real-time Polymerase Chain Reaction, Expressing, Control, Construct, Over Expression

Journal: The FASEB Journal

Article Title: The importance of the ZBED6‐IGF2 axis for metabolic regulation in mouse myoblast cells

doi: 10.1096/fj.201901321r

Figure Lengend Snippet: FIGURE 3 SILAC proteomic and transcriptome analyses of Zbed6−/− and Igf2ΔGGCT myoblasts. A, Expression of identified proteins and genes by SILAC and RNA-seq data in Zbed6−/− (left) and Igf2ΔGGCT (right) myoblasts. The values are presented as log fold change (logFC) to WT cells and colored based on the FDR < 0.05 values. B, Intersection of DE proteins in both Zbed6−/− and Igf2ΔGGCT myoblasts (left), KEGG pathway analysis of the shared 56 DE proteins (right). C, GO analysis of the 325 DE proteins in Zbed6−/− myoblasts. GeneRatio indicates the number of genes found in each term as a proportion of the total number of examined genes. D, Intersection of DE proteins in Zbed6−/− myoblasts and putative ZBED6 targets that are expressed in C2C12 cells and detected by SILAC and RNA-seq (left), the fold changes of genes/proteins with ZBED6 binding sites (right). E, GO analysis of upregulated genes/proteins in Zbed6−/− myoblasts with ZBED6 binding sites

Article Snippet: Mouse myoblast C2C12 cells were obtained from ATCC (CRL-1772), and it is a subclone of the previously established mouse myoblast cell line.11 The cells were maintained in Dulbecco's Modified Eagle Medium (DMEM) with 2 mM lglutamine, 1 mM sodium pyruvate, and 4.5 g/L of glucose (ATCC 30-2001), supplemented with 10% (v/v) heat-inactivated fetal bovine serum (FBS) and penicillin (0.2 U/mL)/ streptomycin (0.2 μg/mL)/l-glutamine (0.2 μg/mL) (Gibco) at 37°C in a 5% CO2 humidified atmosphere.

Techniques: Multiplex sample analysis, Expressing, RNA Sequencing, Binding Assay

Journal: Mediators of Inflammation

Article Title: Elevation of IL-6 and IL-33 Levels in Serum Associated with Lung Fibrosis and Skeletal Muscle Wasting in a Bleomycin-Induced Lung Injury Mouse Model

doi: 10.1155/2019/7947596

Figure Lengend Snippet: IL-6 and IL-33 may synergistically cause muscle atrophy. (a) The quadriceps muscle of the mice was homogenized, and the lysate was analyzed by Western blotting with specific antibodies against STAT3, AMPK, and Atrogin-1. (b) C2C12 cells, mouse adherent myoblasts, were incubated with 2% horse serum for 72 hours and stimulated with recombinant mouse IL-6 and IL-33 in serum-free medium as indicated for 24 hours. The remaining cells were harvested, and the levels of p-STAT3, STAT3, p-AMPK α , and AMPK α in the cell lysate were analyzed by Western blotting. α -Tubulin and GAPDH were used as internal controls. The intensity of bands in the Western blots was measured by ImageJ software. The quantitative data were expressed as the means ± SD. ∗ p < 0.05 compared with control.

Article Snippet: C2C12 mouse adherent myoblasts were obtained from BCRC (Bioresource Collection and Research Center, Hsinchu, Taiwan).

Techniques: Western Blot, Incubation, Recombinant, Software, Control

Journal: International Journal of Molecular Sciences

Article Title: IRE1-XBP1 Pathway of the Unfolded Protein Response Is Required during Early Differentiation of C2C12 Myoblasts

doi: 10.3390/ijms21010182

Figure Lengend Snippet: IRE1 is required in C2C12 differentiation. ( a ) IRE1-knockdown cell lines #1, #2, and mock cells were evaluated for the expression of IRE1/ Ern1 mRNA. Results are means + SEM (three biological replicates). ** p < 0.01. ( b ) Differentiation was induced in IRE1-knockdown cell lines and mock cells. After 48 h, cells were observed under phase contrast. Black arrows show the immature myotubes. Scale bar = 100 µm. ( c , d ) Cells were harvested after differentiation induction at 48 h. mRNA expression of myogenic factors ( c ) and UPR relative factors ( d ) was analyzed by qPCR. Results are means + SEM (three biological replicates). * p < 0.05, ** p < 0.01.

Article Snippet: C2C12 mouse myoblasts were obtained from DS Pharma Biomedical (Osaka, Japan).

Techniques: Knockdown, Expressing

Journal: International Journal of Molecular Sciences

Article Title: IRE1-XBP1 Pathway of the Unfolded Protein Response Is Required during Early Differentiation of C2C12 Myoblasts

doi: 10.3390/ijms21010182

Figure Lengend Snippet: IRE1 ribonuclease activity is required in early phase of C2C12 differentiation. ( a ) Differentiation was induced in the presence or absence of IRE1 RNase inhibitor, STF-083010 (60 µM; black bars) or DMSO (gray bars) for various time intervals as indicated. ( b ) Identification of critical time period for inhibitory effect of IRE1 activity on C2C12 differentiation. Scale bar = 200 µm. ( c ) Fusion index of STF-083010- or DMSO-treated cells. Results are mean + SEM (three biological replicates). The different letters denote significant differences between groups at p < 0.05 by Tukey’s HSD test.

Article Snippet: C2C12 mouse myoblasts were obtained from DS Pharma Biomedical (Osaka, Japan).

Techniques: Activity Assay

Journal: International Journal of Molecular Sciences

Article Title: IRE1-XBP1 Pathway of the Unfolded Protein Response Is Required during Early Differentiation of C2C12 Myoblasts

doi: 10.3390/ijms21010182

Figure Lengend Snippet: XBP1 is required for C2C12 differentiation. ( a ) mRNA expression of Xbp1 and spliced Xbp1 were compared between XBP1-knockdown cells (XBP1-KD) and mock cells. Results are means + SEM (three biological replicates). Student’s t -test. ** p < 0.01. ( b ) XBP1-knockdown cells and mock cells were induced to differentiate until day 5. Cells were observed for immunofluorescent staining with anti-MHC antibody. Scale bar = 200 µm. ( c ) Fusion index of mock or XBP1-KD cells. Results are mean + SEM (three biological replicates). Student’s t -test. ** p < 0.01. ( d ) Cells were harvested on the indicated day. mRNA expression of each myogenic factor was analyzed by qPCR. Results are means + SEM (three biological replicates). Student’s t -test. * p < 0.05, ** p < 0.01.

Article Snippet: C2C12 mouse myoblasts were obtained from DS Pharma Biomedical (Osaka, Japan).

Techniques: Expressing, Knockdown, Staining

Journal: International Journal of Molecular Sciences

Article Title: IRE1-XBP1 Pathway of the Unfolded Protein Response Is Required during Early Differentiation of C2C12 Myoblasts

doi: 10.3390/ijms21010182

Figure Lengend Snippet: CDK5 is a downstream target of IRE1-XBP1 in C2C12 cells. ( a ) mRNA expression of Xbp1 and Cdk5 during C2C12 differentiation. Results are means + SEM (three biological replicates). Student’s t -test. ** p < 0.01. ( b ) An illustration of the predicted mouse Cdk5 promoter region. The region upstream of the Cdk5 gene comprises three XBP1-binding domains including CCAAT at −544 bp, TGCCACGTGG at −597 bp, and CCACGT at −1112 bp from the transcription start site. ( c , d ) Chromatin immunoprecipitation assay using a C2C12 genomic sample. Input DNA = positive control. Rabbit IgG was used as negative control ChIP ( c ). ChIP assay was performed by quantitative PCR analysis ( d ). Results are means + SEM (three biological replicates). Student’s t -test. * p < 0.05. ( e ) XBP1-knockdown and mock cells were transfected with the vector containing the Cdk5 promoter construct ( p 1400) or an empty vector. Cdk5 promoter activity was assessed by luciferase assay. Results are means + SEM (three biological replicates). Student’s t -test. ** p < 0.01.

Article Snippet: C2C12 mouse myoblasts were obtained from DS Pharma Biomedical (Osaka, Japan).

Techniques: Expressing, Binding Assay, Chromatin Immunoprecipitation, Positive Control, Negative Control, Real-time Polymerase Chain Reaction, Knockdown, Transfection, Plasmid Preparation, Construct, Activity Assay, Luciferase

Journal: EMBO Reports

Article Title: SH3KBP1 promotes skeletal myofiber formation and functionality through ER/SR architecture integrity

doi: 10.1038/s44319-025-00413-9

Figure Lengend Snippet: ( A ) Western blot analysis of SH3KBP1 protein levels in total protein extracts obtained from growing (GM) or differentiating C2C12 cells (from 1 to 5 days). C2C12 differentiation is assessed by Myogenin expression and Tubulin is used as loading control. ( B ) RT-qPCR analysis of Sh3kbp1 gene expression level relative to housekeeping genes ( CycloB, Gapdh, GusB, Rpl41 , and Tbp ) in proliferating C2C12 cells (GM) or in differentiating C2C12 (1 to 5 days of differentiation). ( C ) Representative western blots analysis of SH3KBP1 protein downregulation in stable cell line constitutively expressing shRNA construct targeting Sh3kbp1 . Tubulin is used as loading control. ( D , E ) Representative immunofluorescence staining of myosin heavy chain (green) and myonuclei (red) in C2C12 stable cell lines expressing scramble shRNA ( D ) or shRNA targeting Sh3kbp1 ( E ) after 3 or 6 days of differentiation. Zooms are magnifications of images in white dots rectangles in 6 days old myotubes. Scale bars: 150 µm, 15 µm in zoom. ( F , G ) Representatives immunofluorescent staining of myosin heavy chain (green) and myonuclei (red) in stable cell line expressing Sh3kbp1 shRNA, co-transfected with plasmid coding either for mCherry ( F ) or the full-length human SH3KBP1 ( G ) after 5 days of differentiation. Scale bar: 150 µm. ( H ) Quantification of the percentage of myonuclei per clusters observed in ( D – G ) experiments. Statistical analysis performed using unpaired t tests where * P < 0.05; ** P < 0.01; *** P < 0.001. Comparison between shRNA Scramble and ShRNA- sh3kbp1 ( n = 8; biological replicates) for the “4–6” nuclei category P = 0.000014, for the “7–9” nuclei category P = 0.039, for the “10–15” nuclei category P = 0.00016 and for the “+ 15” nuclei category P = 0.004. Comparison between ShRNA- sh3kbp1 and ShRNA- sh3kbp1 + SH3KBP1 ( n = 3; biological replicates) for the “4–6” nuclei category P = 0.00008, for the “10–15” nuclei category P = 0.0076 and for the “+ 15” nuclei category P = 0.04. Boxplot whiskers represent the maximum and minimum data values. Center lines show the medians; box limits indicate the 25th and 75th percentiles as determined by R software and represents the middle 50% of observed values.

Article Snippet: Inhibition of autophagy maturation was performed by treating C2C12 myotubes with Bafilomycin-A1 (MedChemExpress, HY-100558) at 100 nM during 6 h. To generate C2C12 stably expressing shRNAs (shControl or shCin85), cells were transfected with plasmids encoding control shRNA (Mission pLKO.1-Puro non-mammalian shRNA control plasmid, Merck SHC002) or shRNA directed against SH3KBP1 (mission shRNA clone TRCN0000088508 targeting the 3’UTR sequence CCCACCACTCTAAGAGAAATT) and selected using 2 µg/mL of Puromycin (Gibco, A1113803) for 2 weeks.

Techniques: Western Blot, Expressing, Control, Quantitative RT-PCR, Gene Expression, Stable Transfection, shRNA, Construct, Immunofluorescence, Staining, Transfection, Plasmid Preparation, Comparison, Software

Journal: EMBO Reports

Article Title: SH3KBP1 promotes skeletal myofiber formation and functionality through ER/SR architecture integrity

doi: 10.1038/s44319-025-00413-9

Figure Lengend Snippet: ( A ) Representative immunofluorescence staining of 5 days C2C12 myotubes expressing either scramble or Sh3kbp1 shRNA and stained with sirTubulin ® . Scale bars, 10 µm. ( B ) Quantification of the microtubule bundle directionality (orientation angle normalized according to myotubes longitudinal axis) in myotubes using the “directionality plugin” of ImageJ ® . Data are pooled from three independent repeats ( n = 41 cells in scramble condition and n = 61 cells in Sh3kbp1 shRNA condition). “−90°” category P = 0.03; “+80°” category P = 0.02“ + 90°” category P = 0.017. Statistical analysis performed using unpaired t tests where * P < 0.05. Boxplot whiskers represent the maximum and minimum data values. Center lines show the medians; box limits indicate the 25th and 75th percentiles as determined by R software and represents the middle 50% of observed values. ( C, D ) Representative images of immunofluorescent staining of Pericentrin (red), PCM1 (green) and nuclei (Blue) in 5 days differentiated C2C12 myotubes expressing either scramble or Sh3kbp1 shRNA. Scale bars, 10 µm. ( E , F ) Quantification of the myonuclei peripheral staining of Pericentrin ( E ) or PCM1 ( F ) in 5 days differentiated C2C12 myotubes expressing either scramble or Sh3kbp1 shRNA. Data are pooled from three independent repeats. Error bars represent SD ( G ) MAP7 constructs used in the experiment. ( H ) Representative western blot of crude extracts of C2C12 cells expressing various GFP-MAP7 constructs (FL: Full length, NT: N-terminal part of MAP7; NTL: N-terminal long part of MAP7; M: Middle part of MAP7, CT: C-terminal part of MAP7 and CTL: C-terminal long part of MAP7) and GFP-DNM2 and stained for endogenous SH3KBP1 (top) or with anti-GFP (bottom) antibodies. ( I ) Representative western blot after GFP immunoprecipitation (MAP7 and DNM2 constructs) using GFP-Trap in C2C12 cell extracts ( H ). The membrane was revealed with anti-GFP (bottom) and anti-SH3KBP1 (Top) antibodies n .>3.

Article Snippet: Inhibition of autophagy maturation was performed by treating C2C12 myotubes with Bafilomycin-A1 (MedChemExpress, HY-100558) at 100 nM during 6 h. To generate C2C12 stably expressing shRNAs (shControl or shCin85), cells were transfected with plasmids encoding control shRNA (Mission pLKO.1-Puro non-mammalian shRNA control plasmid, Merck SHC002) or shRNA directed against SH3KBP1 (mission shRNA clone TRCN0000088508 targeting the 3’UTR sequence CCCACCACTCTAAGAGAAATT) and selected using 2 µg/mL of Puromycin (Gibco, A1113803) for 2 weeks.

Techniques: Immunofluorescence, Staining, Expressing, shRNA, Software, Construct, Western Blot, Immunoprecipitation, Membrane

Journal: EMBO Reports

Article Title: SH3KBP1 promotes skeletal myofiber formation and functionality through ER/SR architecture integrity

doi: 10.1038/s44319-025-00413-9

Figure Lengend Snippet: ( A ) SH3KBP1 constructs used in the experiment. ( B ) Representative western blot of crude extracts of C2C12 cells co-expressing GFP-DNM2 and various Flag-SH3KBP1 constructs (FL full length, N-term N-terminal part of SH3KBP1, C-term C-terminal part of SH3KBP1) and stained with anti-GFP (top) or anti-Flag (bottom) antibodies. ( C ) Representative western blot after DNM2-GFP immunoprecipitation using GFP-Trap and aforementioned C2C12 cell extracts ( B ). The membrane was revealed with anti-GFP (top), anti-Flag (middle) and anti-SH3KBP1 (bottom) antibodies. ( B , C ) Blots were repeated more than three times. ( D ) Representative images of extracted Tibialis Anterior muscle fiber stained for SH3KBP1 (green), DNM2 (red) and myonuclei (blue) (single Z plan). Scale bars, 10 µm. ( E ) Representative images of extracted Tibialis Anterior muscle fiber stained for SH3KBP1 (green), DHPR1α (for DyHydroPyridine Receptor alpha, red) and myonuclei (blue) (Max intensity of Z stacks plans). Scale bars, 10 µm. ( F ) Representative immunofluorescent staining of SH3KBP1 (green), Actin (red) and myonuclei (blue) in the time course of C2C12 cells differentiation: proliferation (Prolif) and 3 or 5 days of differentiation (diff day 3, diff day 5) are presented. ( G ) Representative immunofluorescent staining of SH3KBP1 (green), Actin (red) and myonuclei (blue or red) along the time course of primary myoblasts cells differentiation: proliferation (Prolif) and 3 or 10 days of differentiation (diff day 3, diff day 10) are presented. Scale bars, 10 µm.

Article Snippet: Inhibition of autophagy maturation was performed by treating C2C12 myotubes with Bafilomycin-A1 (MedChemExpress, HY-100558) at 100 nM during 6 h. To generate C2C12 stably expressing shRNAs (shControl or shCin85), cells were transfected with plasmids encoding control shRNA (Mission pLKO.1-Puro non-mammalian shRNA control plasmid, Merck SHC002) or shRNA directed against SH3KBP1 (mission shRNA clone TRCN0000088508 targeting the 3’UTR sequence CCCACCACTCTAAGAGAAATT) and selected using 2 µg/mL of Puromycin (Gibco, A1113803) for 2 weeks.

Techniques: Construct, Western Blot, Expressing, Staining, Immunoprecipitation, Membrane

Journal: EMBO Reports

Article Title: SH3KBP1 promotes skeletal myofiber formation and functionality through ER/SR architecture integrity

doi: 10.1038/s44319-025-00413-9

Figure Lengend Snippet: ( A , B ) Representative Immunofluorescent staining of Golgi (RCAS1, red) ( A ) or Endoplasmic Reticulum (ERP72, red) ( B ) and myonuclei (DAPI, blue) in 6 days differentiated C2C12 cells expressing either scramble-GFP-shRNA or GFP-shRNA targeting Sh3kbp1 gene. Scale bars, 100 µm. Zooms 1–4 are magnifications of the images in white dots. Scale bars: 100 µm. ( C ) GFP-tagged SH3KBP1 constructs used in the experiment. ( D ) Representative western blot performed on crude extracts of C2C12 cells expressing GFP-SH3KBP1 constructs and stained with anti-ERP72 (Top), anti-Calnexin (middle) and anti-GFP (bottom) antibodies. ( E ) Representative western blot performed after SH3KBP1-GFP construct immunoprecipitation (GFP trap assay) of C2C12 cells extracts ( D ) and stained with anti-ERP72 (top), anti-Calnexin (middle) and anti-GFP (bottom) antibodies. Blots were repeated more than three times. ( F ) Representative immunofluorescent images of GFP-SH3KBP1 constructs expression in 10 days cultured primary myofibers. (GFP, green; Actin, red and myonuclei, blue) Scale bars, 5 µm. ( G ) Control (Sh-Scramble) and SH3KBP1-depleted (Sh- Sh3kbp1 ) C212 myotubes, differentiated for 6 days, were analyzed for their content of LC3-I/LC3-II and SH3KBP1 proteins by western blot; Actin labeling was used as a loading control. ( H ) Fold change quantification of LC3-II/Actin ratios reported to the Scramble condition. ( n = 3; biological replicates) P = 0.002. Statistical analysis performed using unpaired t tests where ** P < 0.01. ( I ) Control (Sh-Scramble) and SH3KBP1-depleted (Sh- Sh3kbp1 ) C212 myotubes differentiated for 6 days were either left untreated or treated with 100 nM of bafilomycin-A1 during 6 h. After total protein extraction, LC3-I/LC3-II and Actin levels were analyzed by immunoblot. ( J ) Fold change quantification of LC3-II/Actin ratios reported to the untreated condition in each condition (Scramble or Sh3KBP1) ( n = 3; biological replicates) P = 0.0011. Statistical analysis performed using unpaired t tests where ** P < 0.01. ( K ) Quantification of the percentage of highly LC3-II positive myofibers in Tibialis Anterior muscles from WT or KI- Dnm2 R465W/+ injected with either PBS or shRNA targeting SH3KBP1 mRNA ( n > 3; biological replicates). Comparison between WT and WT-ShRNA- sh3kbp1 P = 0.0059, KI-DNM2 R465W and KI-DNM2 R465W -ShRNA- sh3kbp1 P = 0.0056. Statistical analysis performed using unpaired t tests where ** P < 0.01. Boxplot whiskers represent the maximum and minimum data values. Center lines show the medians; box limits indicate the 25th and 75th percentiles as determined by R software and represents the middle 50% of observed values. ( L ) Representative electron microscopy images of myofibrils and triads organization within Flexor digitalis Brevis muscles from WT mice injected with either PBS or AAV cognate vector expressing shRNA targeting SH3KBP1 mRNA. Scale bar = 0.2 µm or 100 nm.

Article Snippet: Inhibition of autophagy maturation was performed by treating C2C12 myotubes with Bafilomycin-A1 (MedChemExpress, HY-100558) at 100 nM during 6 h. To generate C2C12 stably expressing shRNAs (shControl or shCin85), cells were transfected with plasmids encoding control shRNA (Mission pLKO.1-Puro non-mammalian shRNA control plasmid, Merck SHC002) or shRNA directed against SH3KBP1 (mission shRNA clone TRCN0000088508 targeting the 3’UTR sequence CCCACCACTCTAAGAGAAATT) and selected using 2 µg/mL of Puromycin (Gibco, A1113803) for 2 weeks.

Techniques: Staining, Expressing, shRNA, Construct, Western Blot, Immunoprecipitation, TRAP Assay, Cell Culture, Control, Labeling, Protein Extraction, Muscles, Injection, Comparison, Software, Electron Microscopy, Plasmid Preparation

Journal: Skeletal Muscle

Article Title: MiR-1290 promotes myoblast differentiation and protects against myotube atrophy via Akt/p70/FoxO3 pathway regulation

doi: 10.1186/s13395-021-00262-9

Figure Lengend Snippet: The effect of miR-1290 mimic transfection on C2C12 cells. a and b The MHC staining of C2C12 myoblast with miR-1290 or miR-NC and quantification of MHC area (scale bar, 50 μm). c – f The western blot analysis and quantification of MHC, MyoD, and MyoG after transfection of miRNAs. GAPDH was used as an internal control for western blot analysis. The statistical difference among miR-1290 transfection group and control group were considered significant at the levels of * P < 0.05, ** P < 0.01, or *** P < 0.001

Article Snippet: The mouse myoblast C2C12 cells were provided by Cyagen Biosciences, Inc., and cultured in DMEM containing 1% penicillin-streptomycin and 10% fetal bovine serum following the American Type Culture collection instructions.

Techniques: Transfection, Staining, Western Blot, Control

Journal: Skeletal Muscle

Article Title: MiR-1290 promotes myoblast differentiation and protects against myotube atrophy via Akt/p70/FoxO3 pathway regulation

doi: 10.1186/s13395-021-00262-9

Figure Lengend Snippet: The effect of miR-1290 mimic transfection on C2C12 cells under TNF-α. a and b Giemsa staining and myotube diameters among all groups. c – e The western blot analysis and quantification of MuRF1 and atrogin-1 after overexpression of miR-1290 in TNF-α-induced atrophy. GAPDH was used as an internal control for western blot analysis. The statistical difference among miR-1290 transfection group and other groups were considered significant at the levels of * P < 0.05, ** P < 0.01, or *** P < 0.001

Article Snippet: The mouse myoblast C2C12 cells were provided by Cyagen Biosciences, Inc., and cultured in DMEM containing 1% penicillin-streptomycin and 10% fetal bovine serum following the American Type Culture collection instructions.

Techniques: Transfection, Staining, Western Blot, Over Expression, Control

Journal: Skeletal Muscle

Article Title: MiR-1290 promotes myoblast differentiation and protects against myotube atrophy via Akt/p70/FoxO3 pathway regulation

doi: 10.1186/s13395-021-00262-9

Figure Lengend Snippet: The intrinsic mechanism of miR-1290’s effect. a Bioinformatics analysis was performed to predict the miR-1290-binding seed sequence in the 3’UTR of FoxO3. b The luciferase result of miR-1290 and FOXO3. c and d The western blot analysis and quantification to determine FoxO3 levels in cytoplasm and nucleus in miR-1290-transfected C2C12 myoblast. e and f The knockdown efficiency of FoxO3-specific siRNA was confirmed by western blot. g and h MHC staining was performed after FoxO3 knockdown (scale bar, 50 μm). i and j . The expression of MyoD and MyoG were analyzed by western blot. GAPDH and Lamin B1 are cytoplasmic and nuclear protein loading controls, respectively. The statistical difference among miR-1290 transfection group and other groups were considered significant at the levels of * P < 0.05, ** P < 0.01, or *** P < 0.001

Article Snippet: The mouse myoblast C2C12 cells were provided by Cyagen Biosciences, Inc., and cultured in DMEM containing 1% penicillin-streptomycin and 10% fetal bovine serum following the American Type Culture collection instructions.

Techniques: Binding Assay, Sequencing, Luciferase, Western Blot, Transfection, Knockdown, Staining, Expressing

Journal: Skeletal Muscle

Article Title: MiR-1290 promotes myoblast differentiation and protects against myotube atrophy via Akt/p70/FoxO3 pathway regulation

doi: 10.1186/s13395-021-00262-9

Figure Lengend Snippet: MiR-1290 activates AKT/P70/FoxO3 signaling pathways during myoblast differentiation. a MHC staining performed after treated miR-1290/miR-NC with or without GDC-0068 (scale bar, 50 μm). b MHC-positive areas/total areas were quantified using Harmony 4.1 software ( n = 6). c – f The western blot analysis and quantification of phosphorylated and all forms of AKT and P70, MyoG, and MyoD, after transfecting miR-1290/miR-NC with or without GDC0068. GDC-0068 inhibited miR-1290-activated phosphorylation of AKT and P70 in C2C12 myoblasts. Western blot to analyze FoxO3 expression levels in cytoplasm and nucleus of C2C12 myoblasts. GAPDH and Lamin B1 are cytoplasmic and nuclear protein loading controls, respectively. The statistical difference among miR-1290 transfection group and inhibitor group were considered significant at the levels of * P < 0.05, ** P < 0.01, or *** P < 0.001

Article Snippet: The mouse myoblast C2C12 cells were provided by Cyagen Biosciences, Inc., and cultured in DMEM containing 1% penicillin-streptomycin and 10% fetal bovine serum following the American Type Culture collection instructions.

Techniques: Protein-Protein interactions, Staining, Software, Western Blot, Phospho-proteomics, Expressing, Transfection

Journal: Skeletal Muscle

Article Title: MiR-1290 promotes myoblast differentiation and protects against myotube atrophy via Akt/p70/FoxO3 pathway regulation

doi: 10.1186/s13395-021-00262-9

Figure Lengend Snippet: Role of Protein kinase B (AKT)/P70/FOXO3 signaling pathway in effect of miR-1290 on myotube atrophy. a Giemsa staining was performed to calculate myotube diameters for TNF-α + miR-NC or TNF-α + miR-NC + GDC0068, TNF-α + miR-1290 or TNF-α + miR-1290 + GDC0068 treatments. b Cell diameters of five groups were measured. c – f Western blot analysis and quantification of phosphorylated and all forms of AKT and P70 of C1C12 myotubes for TNF-α + miR-NC or TNF-α + miR-NC + GDC0068, TNF-α + miR-1290 or TNF-α + miR-1290 + GDC0068 treatments. Western blot was performed to analyze the expression of MuRF1 and atrogin-1 in TNF-α + miR-NC or TNF-α + miR-NC + GDC0068, TNF-α + miR-1290 or TNF-α + miR-1290 + GDC0068 groups. After treatment with miR-1290/miR-NC or with GDC-0068, FoxO3 expression levels in cytoplasm and nucleus of C2C12 myotubes were examined by western blot. GAPDH and Lamin B1 are cytoplasmic and nuclear protein loading controls, respectively. The statistical difference among miR-1290 transfection group and inhibitor group were considered significant at the levels of * P < 0.05, ** P < 0.01, or *** P < 0.001

Article Snippet: The mouse myoblast C2C12 cells were provided by Cyagen Biosciences, Inc., and cultured in DMEM containing 1% penicillin-streptomycin and 10% fetal bovine serum following the American Type Culture collection instructions.

Techniques: Staining, Western Blot, Expressing, Transfection

Journal: eLife

Article Title: CRELD1 is an evolutionarily-conserved maturational enhancer of ionotropic acetylcholine receptors

doi: 10.7554/eLife.39649

Figure Lengend Snippet: ( A–E ) Measurement of mouse CRELD1 and AChR α subunit protein levels. C2C12 cells expressing shRNA against Creld1 ( shCreld1 ) or scrambled ( shScramble ) sequences were differentiated for 5 days and then subjected to surface labeling with αBT-biotin for AChRα. N.T. = non transfected cells. Streptavidin precipitates (surface) and total lysates were separated by SDS/PAGE and probed for indicated proteins ( A and C ). CRELD1 protein levels were reduced by 75% in cells expressing shCreld1 as compared to shScramble ( B ). Quantitation of total AChRα levels ( D ) and of the surface to total AChRα ratio ( E ) in shScramble (100%) and shCreld1 cells from n = 5 independent experiments. Error bars, SEM; **p=0,0079, Mann-Whitney test. ( F–G ) Measurement of mouse Creld1 and AChRα subunit mRNA levels. C2C12 cells expressing shScramble or shCreld1 were differentiated for 5 days and then subjected to RNA extraction. Quantitative real-time PCR measurements of mRNA levels for Creld1 ( F ) and AChRα subunit ( G ). Creld1 mRNA is decreased in shCreld1 cells compared to shScramble cells, whereas AChRα subunit mRNA is not significantly decreased in shCreld-1 cells. Mean ± SEM is shown in six independent experiments. *p=0,0411; p=0,4740, ns (not significant), Mann–Whitney test.

Article Snippet: Sh-Creld1 and control myoblast lines were obtained by selecting puromycin-resistant clones of C2C12 myoblasts, respectively transfected with shRNA clone set against mouse Creld1 or scrambled control clone (GeneCopoeia).

Techniques: Expressing, shRNA, Labeling, Transfection, SDS Page, Quantitation Assay, MANN-WHITNEY, RNA Extraction, Real-time Polymerase Chain Reaction

Journal: eLife

Article Title: CRELD1 is an evolutionarily-conserved maturational enhancer of ionotropic acetylcholine receptors

doi: 10.7554/eLife.39649

Figure Lengend Snippet: C2C12 cells expressing Scramble or Creld1 shRNA were differentiated for 5 days, and then subjected to RNA extraction. Quantitative real-time PCR measurements of mRNA levels shows that Myogenin is not significantly decreased in shCreld-1 cells. Fold-change, mean ± SEM in shCreld-1 relative to shScramble (100%) is shown in four independent experiments. p>0,9999, ns (not significant), Mann–Whitney test.

Article Snippet: Sh-Creld1 and control myoblast lines were obtained by selecting puromycin-resistant clones of C2C12 myoblasts, respectively transfected with shRNA clone set against mouse Creld1 or scrambled control clone (GeneCopoeia).

Techniques: Expressing, shRNA, RNA Extraction, Real-time Polymerase Chain Reaction, MANN-WHITNEY

Journal: eLife

Article Title: CRELD1 is an evolutionarily-conserved maturational enhancer of ionotropic acetylcholine receptors

doi: 10.7554/eLife.39649

Figure Lengend Snippet:

Article Snippet: Sh-Creld1 and control myoblast lines were obtained by selecting puromycin-resistant clones of C2C12 myoblasts, respectively transfected with shRNA clone set against mouse Creld1 or scrambled control clone (GeneCopoeia).

Techniques: Disruption, Recombinant, shRNA, Plasmid Preparation, Cell Culture, Western Blot, Labeling, Purification, Transduction, Mutagenesis, Sequencing, cDNA Synthesis